Phylogenetic analysis of Dermatophilus congolensis isolated from naturally infected cattle in Abeokuta and Ilorin, Nigeria

Dermatophilus congolensis, the aetiological agent of dermatophilosis, is a pleomorphic, Gram‐positive actinomycete, which infects animals and humans. Often, there is a wrong diagnosis of the infection in animals because of the close resemblance of the organism with other members of the family Actinomycetaceae. In this study, molecular tools were applied to suspected isolates of D. congolensis obtained from naturally infected cattle in Nigeria for confirmation of dermatophilosis. DNA extraction from 54 suspected pure colonies of D. congolensis was carried out using the QIAamp(®) DNA Mini extraction kit. PCR targeted at the 16S rRNA gene was employed for the confirmation of D. congolensis using 5′‐ACATGCAAGTCGAACGATGA‐3′ and 5′‐ACGCTCGCACCCTACGTATT‐3′ as forward and reverse primers, respectively. Positive amplicons were then sequenced directly using Big Dye Terminator Cycle Sequencing Kit with the forward primers and AmpliTaq‐FS DNA Polymerase. Nucleotide sequences were aligned using bioedit (Ibis Biosciences Carlsbad, CA USA) and the phylogenetic analysis was carried out using mega 5.2 (Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Tempe, Arizona, USA) software programme. The aligned nucleotide sequences of 10 positive D. congolensis isolates had between 94% to 99% homology with the sequences of D. congolensis satellite DNA in GenBank. This result also revealed that the sequenced D. congolensis are of different strains. Phylogenetic analysis revealed that D. congolensis, though closely related to Nocardia brasiliensis (NR 074743.01) and Streptomyces sp. (JN 400114.1), belongs to different genus. In conclusion, molecular tools employed in the study were able to confirm the identity of the test organisms as D. congolensis. It can also be concluded that two strains of D. congolensis obtained from the study can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D. congolensis not yet listed in GenBank.