Cargando…
Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms
BACKGROUND AND AIM: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs pro...
Autores principales: | , , |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
Veterinary World
2018
|
Materias: | |
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5993761/ https://www.ncbi.nlm.nih.gov/pubmed/29915505 http://dx.doi.org/10.14202/vetworld.2018.657-666 |
_version_ | 1783330275829219328 |
---|---|
author | Triosanti, Lucia S. Wibowo, Michael Haryadi Widayanti, Rini |
author_facet | Triosanti, Lucia S. Wibowo, Michael Haryadi Widayanti, Rini |
author_sort | Triosanti, Lucia S. |
collection | PubMed |
description | BACKGROUND AND AIM: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. MATERIALS AND METHODS: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. RESULT: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. CONCLUSION: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures. |
format | Online Article Text |
id | pubmed-5993761 |
institution | National Center for Biotechnology Information |
language | English |
publishDate | 2018 |
publisher | Veterinary World |
record_format | MEDLINE/PubMed |
spelling | pubmed-59937612018-06-18 Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms Triosanti, Lucia S. Wibowo, Michael Haryadi Widayanti, Rini Vet World Review Article BACKGROUND AND AIM: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. MATERIALS AND METHODS: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. RESULT: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. CONCLUSION: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures. Veterinary World 2018-05 2018-05-20 /pmc/articles/PMC5993761/ /pubmed/29915505 http://dx.doi.org/10.14202/vetworld.2018.657-666 Text en Copyright: © Triosanti, et al. http://creativecommons.org/licenses/by/4.0 Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. |
spellingShingle | Review Article Triosanti, Lucia S. Wibowo, Michael Haryadi Widayanti, Rini Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms |
title | Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms |
title_full | Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms |
title_fullStr | Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms |
title_full_unstemmed | Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms |
title_short | Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms |
title_sort | molecular characterization of hemagglutinin-neuraminidase fragment gene of newcastle disease virus isolated from periodically-vaccinated farms |
topic | Review Article |
url | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5993761/ https://www.ncbi.nlm.nih.gov/pubmed/29915505 http://dx.doi.org/10.14202/vetworld.2018.657-666 |
work_keys_str_mv | AT triosantilucias molecularcharacterizationofhemagglutininneuraminidasefragmentgeneofnewcastlediseasevirusisolatedfromperiodicallyvaccinatedfarms AT wibowomichaelharyadi molecularcharacterizationofhemagglutininneuraminidasefragmentgeneofnewcastlediseasevirusisolatedfromperiodicallyvaccinatedfarms AT widayantirini molecularcharacterizationofhemagglutininneuraminidasefragmentgeneofnewcastlediseasevirusisolatedfromperiodicallyvaccinatedfarms |