Cargando…
Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected...
Autores principales: | , , , , , , , , , |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
MDPI
2018
|
Materias: | |
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6162610/ https://www.ncbi.nlm.nih.gov/pubmed/30189613 http://dx.doi.org/10.3390/genes9090442 |
_version_ | 1783359180498796544 |
---|---|
author | Liu, Chang Chen, Ze Hu, Yue Ji, Haishuo Yu, Deshui Shen, Wenyuan Li, Siyu Ruan, Jishou Bu, Wenjun Gao, Shan |
author_facet | Liu, Chang Chen, Ze Hu, Yue Ji, Haishuo Yu, Deshui Shen, Wenyuan Li, Siyu Ruan, Jishou Bu, Wenjun Gao, Shan |
author_sort | Liu, Chang |
collection | PubMed |
description | In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. |
format | Online Article Text |
id | pubmed-6162610 |
institution | National Center for Biotechnology Information |
language | English |
publishDate | 2018 |
publisher | MDPI |
record_format | MEDLINE/PubMed |
spelling | pubmed-61626102018-10-10 Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus Liu, Chang Chen, Ze Hu, Yue Ji, Haishuo Yu, Deshui Shen, Wenyuan Li, Siyu Ruan, Jishou Bu, Wenjun Gao, Shan Genes (Basel) Article In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. MDPI 2018-09-05 /pmc/articles/PMC6162610/ /pubmed/30189613 http://dx.doi.org/10.3390/genes9090442 Text en © 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/). |
spellingShingle | Article Liu, Chang Chen, Ze Hu, Yue Ji, Haishuo Yu, Deshui Shen, Wenyuan Li, Siyu Ruan, Jishou Bu, Wenjun Gao, Shan Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus |
title | Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus |
title_full | Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus |
title_fullStr | Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus |
title_full_unstemmed | Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus |
title_short | Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus |
title_sort | complemented palindromic small rnas first discovered from sars coronavirus |
topic | Article |
url | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6162610/ https://www.ncbi.nlm.nih.gov/pubmed/30189613 http://dx.doi.org/10.3390/genes9090442 |
work_keys_str_mv | AT liuchang complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT chenze complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT huyue complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT jihaishuo complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT yudeshui complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT shenwenyuan complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT lisiyu complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT ruanjishou complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT buwenjun complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus AT gaoshan complementedpalindromicsmallrnasfirstdiscoveredfromsarscoronavirus |