Cargando…
Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation
G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy....
Autores principales: | Cui, Xiaojie, Chen, Han, Zhang, Qiang, Xu, Ming, Yuan, Gu, Zhou, Jiang |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
Nature Publishing Group UK
2019
|
Materias: | |
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6408435/ https://www.ncbi.nlm.nih.gov/pubmed/30850693 http://dx.doi.org/10.1038/s41598-019-39941-5 |
Ejemplares similares
-
G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription
por: Cogoi, Susanna, et al.
Publicado: (2006) -
The Promoter Region of the Proto-Oncogene MST1R Contains the Main Features of G-Quadruplexes Formation
por: Robert, Coralie, et al.
Publicado: (2022) -
Sequencing and G-Quadruplex Folding of the Canine Proto-Oncogene KIT Promoter Region: Might Dog Be Used as a Model for Human Disease?
por: Da Ros, Silvia, et al.
Publicado: (2014) -
Nanomechanics of G-quadruplexes within the promoter of the KIT oncogene
por: Buglione, Enrico, et al.
Publicado: (2021) -
Existence of G-quadruplex structures in promoter region of oncogenes confirmed by G-quadruplex DNA cross-linking strategy
por: Yuan, Libo, et al.
Publicado: (2013)