Cargando…
Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis
BACKGROUND: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. METHODS: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followe...
Autores principales: | , , , , , , , , |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
Frontiers Media S.A.
2020
|
Materias: | |
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7010634/ https://www.ncbi.nlm.nih.gov/pubmed/32117440 http://dx.doi.org/10.3389/fgene.2020.00021 |
_version_ | 1783495906673295360 |
---|---|
author | Han, Yang Wang, Xiuli Zheng, Liyun Zhu, Tingting Li, Yuwei Hong, Jiaqi Xu, Congcong Wang, Peiguang Gao, Min |
author_facet | Han, Yang Wang, Xiuli Zheng, Liyun Zhu, Tingting Li, Yuwei Hong, Jiaqi Xu, Congcong Wang, Peiguang Gao, Min |
author_sort | Han, Yang |
collection | PubMed |
description | BACKGROUND: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. METHODS: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ(2)- and Fisher's tests were used to analyze the genotype–phenotype correlations. RESULTS: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). CONCLUSIONS: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling. |
format | Online Article Text |
id | pubmed-7010634 |
institution | National Center for Biotechnology Information |
language | English |
publishDate | 2020 |
publisher | Frontiers Media S.A. |
record_format | MEDLINE/PubMed |
spelling | pubmed-70106342020-02-28 Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis Han, Yang Wang, Xiuli Zheng, Liyun Zhu, Tingting Li, Yuwei Hong, Jiaqi Xu, Congcong Wang, Peiguang Gao, Min Front Genet Genetics BACKGROUND: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. METHODS: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ(2)- and Fisher's tests were used to analyze the genotype–phenotype correlations. RESULTS: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). CONCLUSIONS: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling. Frontiers Media S.A. 2020-02-04 /pmc/articles/PMC7010634/ /pubmed/32117440 http://dx.doi.org/10.3389/fgene.2020.00021 Text en Copyright © 2020 Han, Wang, Zheng, Zhu, Li, Hong, Xu, Wang and Gao http://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. |
spellingShingle | Genetics Han, Yang Wang, Xiuli Zheng, Liyun Zhu, Tingting Li, Yuwei Hong, Jiaqi Xu, Congcong Wang, Peiguang Gao, Min Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
title | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
title_full | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
title_fullStr | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
title_full_unstemmed | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
title_short | Pathogenic EDA Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype–Phenotype: A Correlation Analysis |
title_sort | pathogenic eda mutations in chinese han families with hypohidrotic ectodermal dysplasia and genotype–phenotype: a correlation analysis |
topic | Genetics |
url | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7010634/ https://www.ncbi.nlm.nih.gov/pubmed/32117440 http://dx.doi.org/10.3389/fgene.2020.00021 |
work_keys_str_mv | AT hanyang pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT wangxiuli pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT zhengliyun pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT zhutingting pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT liyuwei pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT hongjiaqi pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT xucongcong pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT wangpeiguang pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis AT gaomin pathogenicedamutationsinchinesehanfamilieswithhypohidroticectodermaldysplasiaandgenotypephenotypeacorrelationanalysis |