Cargando…

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K(+)-induced conformational transition from an initial hairpin structure to the final G4(...

Descripción completa

Detalles Bibliográficos
Autores principales:	Wang, Zi-Fu, Li, Ming-Hao, Chu, I-Te, Winnerdy, Fernaldo R, Phan, Anh T, Chang, Ta-Chau
Formato:	Online Artículo Texto
Lenguaje:	English
Publicado:	Oxford University Press 2020
Materias:	Chemical Biology and Nucleic Acid Chemistry
Acceso en línea:	https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7026657/ https://www.ncbi.nlm.nih.gov/pubmed/31912153 http://dx.doi.org/10.1093/nar/gkz1207

Ejemplares similares

Epigenetic modification of cytosines fine tunes the stability of i-motif DNA
por: Wright, Elisé P, et al.
Publicado: (2020)

Unprecedented reactivity of polyamines with aldehydic DNA modifications: structural determinants of reactivity, characterization and enzymatic stability of adducts
por: Gusti Ngurah Putu, Eka Putra, et al.
Publicado: (2023)

Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification
por: Lech, Christopher Jacques, et al.
Publicado: (2017)

Specific targeting of cytosine methylation to DNA sequences in vivo
por: Smith, Alexander E., et al.
Publicado: (2007)

i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions
por: Dvořáková, Zuzana, et al.
Publicado: (2018)

Unprecedented hour-long residence time of a cation in a left-handed G-quadruplex
por: Winnerdy, Fernaldo Richtia, et al.
Publicado: (2021)

Direct observation of cytosine flipping and covalent catalysis in a DNA methyltransferase
por: Gerasimaitė, Rūta, et al.
Publicado: (2011)

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex
por: Toh, Desiree-Faye Kaixin, et al.
Publicado: (2016)

Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA
por: Lukinavičius, Gražvydas, et al.
Publicado: (2012)

Sequence- and structure-specific cytosine-5 mRNA methylation by NSUN6
por: Selmi, Tommaso, et al.
Publicado: (2020)

Intermolecular ‘cross-torque’: the N(4)-cytosine propargyl residue is rotated to the ‘CH’-edge as a result of Watson–Crick interaction
por: Domingo, Olwen, et al.
Publicado: (2015)

Sinorhizobium meliloti YbeY is an endoribonuclease with unprecedented catalytic features, acting as silencing enzyme in riboregulation
por: Saramago, Margarida, et al.
Publicado: (2017)

Hyperthermophilic Aquifex aeolicus initiates primer synthesis on a limited set of trinucleotides comprised of cytosines and guanines
por: Larson, Marilynn A., et al.
Publicado: (2008)

Small RNA-mediated DNA (cytosine-5) methyltransferase 1 inhibition leads to aberrant DNA methylation
por: Zhang, Guoqiang, et al.
Publicado: (2015)

Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage
por: Narula, Gagandeep, et al.
Publicado: (2012)

I-Motif/miniduplex hybrid structures bind benzothiazole dyes with unprecedented efficiencies: a generic light-up system for label-free DNA nanoassemblies and bioimaging
por: Shi, Lili, et al.
Publicado: (2020)

Modification of the aminopyridine unit of 2′-deoxyaminopyridinyl-pseudocytidine allowing triplex formation at CG interruptions in homopurine sequences
por: Wang, Lei, et al.
Publicado: (2018)

Direct evidence of mitochondrial G-quadruplex DNA by using fluorescent anti-cancer agents
por: Huang, Wei-Chun, et al.
Publicado: (2015)

The effects of DNA supercoiling on G-quadruplex formation
por: Sekibo, Doreen A.T., et al.
Publicado: (2017)

Yeast Kre33 and human NAT10 are conserved 18S rRNA cytosine acetyltransferases that modify tRNAs assisted by the adaptor Tan1/THUMPD1
por: Sharma, Sunny, et al.
Publicado: (2015)

Excision-reintegration at a pneumococcal phase-variable restriction-modification locus drives within- and between-strain epigenetic differentiation and inhibits gene acquisition
por: Kwun, Min Jung, et al.
Publicado: (2018)

2′-Fluoroarabinonucleic acid modification traps G-quadruplex and i-motif structures in human telomeric DNA
por: Abou Assi, Hala, et al.
Publicado: (2017)

Single-molecule optical mapping of the distribution of DNA phosphorothioate epigenetics
por: Wei, Yue, et al.
Publicado: (2021)

Influence of 5-N-carboxamide modifications on the thermodynamic stability of oligonucleotides
por: Wolk, Steven K., et al.
Publicado: (2015)

Landscape of the complete RNA chemical modifications in the human 80S ribosome
por: Taoka, Masato, et al.
Publicado: (2018)

Enzymatic deamination of the epigenetic nucleoside N(6)-methyladenosine regulates gene expression
por: Jiang, Zhuoran, et al.
Publicado: (2021)

Novel m4C modification in type I restriction-modification systems
por: Morgan, Richard D., et al.
Publicado: (2016)

Modification of orthogonal tRNAs: unexpected consequences for sense codon reassignment
por: Biddle, Wil, et al.
Publicado: (2016)

Identification of nucleobase chemical modifications that reduce the hepatotoxicity of gapmer antisense oligonucleotides
por: Yoshida, Tokuyuki, et al.
Publicado: (2022)

Nucleobase modification by an RNA enzyme
por: Poudyal, Raghav R., et al.
Publicado: (2017)

Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases
por: Raindlová, Veronika, et al.
Publicado: (2016)

One-step enzymatic modification of RNA 3′ termini using polymerase θ
por: Thomas, Crystal, et al.
Publicado: (2019)

The nature of the modification at position 37 of tRNA(Phe) correlates with acquired taxol resistance
por: Pan, Yu, et al.
Publicado: (2020)

The MmeI family: type II restriction–modification enzymes that employ single-strand modification for host protection
por: Morgan, Richard D., et al.
Publicado: (2009)

Mechanistic alternatives for peptide bond formation on the ribosome
por: Kazemi, Masoud, et al.
Publicado: (2018)

Comparison of the efficacy of MOE and PMO modifications of systemic antisense oligonucleotides in a severe SMA mouse model
por: Sheng, Lei, et al.
Publicado: (2020)

5′ modifications to CRISPR–Cas9 gRNA can change the dynamics and size of R-loops and inhibit DNA cleavage
por: Mullally, Grace, et al.
Publicado: (2020)

Regioselective formation of RNA strands in the absence of magnesium ions
por: Motsch, Sebastian, et al.
Publicado: (2020)

Structural basis for the synergy of 4′- and 2′-modifications on siRNA nuclease resistance, thermal stability and RNAi activity
por: Harp, Joel M, et al.
Publicado: (2018)

The effect of adenine protonation on RNA phosphodiester backbone bond cleavage elucidated by deaza-nucleobase modifications and mass spectrometry
por: Fuchs, Elisabeth, et al.
Publicado: (2019)

Cannot write session to /tmp/vufind_sessions/sess_i02tcn08jihec3fcv9h2k5ennb