Cargando…

Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KC...

Descripción completa

Detalles Bibliográficos
Autores principales: Du, Fengli, Wang, Guangxin, Wang, Dawei, Su, Guoying, Yao, Guixiang, Zhang, Wei, Su, Guohai
Formato: Online Artículo Texto
Lenguaje:English
Publicado: Wolters Kluwer Health 2020
Materias:
Acceso en línea:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7220270/
https://www.ncbi.nlm.nih.gov/pubmed/32311972
http://dx.doi.org/10.1097/MD.0000000000019749
_version_ 1783533122436988928
author Du, Fengli
Wang, Guangxin
Wang, Dawei
Su, Guoying
Yao, Guixiang
Zhang, Wei
Su, Guohai
author_facet Du, Fengli
Wang, Guangxin
Wang, Dawei
Su, Guoying
Yao, Guixiang
Zhang, Wei
Su, Guohai
author_sort Du, Fengli
collection PubMed
description INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128(th) residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.
format Online
Article
Text
id pubmed-7220270
institution National Center for Biotechnology Information
language English
publishDate 2020
publisher Wolters Kluwer Health
record_format MEDLINE/PubMed
spelling pubmed-72202702020-06-15 Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases Du, Fengli Wang, Guangxin Wang, Dawei Su, Guoying Yao, Guixiang Zhang, Wei Su, Guohai Medicine (Baltimore) 3400 INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128(th) residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS. Wolters Kluwer Health 2020-04-17 /pmc/articles/PMC7220270/ /pubmed/32311972 http://dx.doi.org/10.1097/MD.0000000000019749 Text en Copyright © 2020 the Author(s). Published by Wolters Kluwer Health, Inc. http://creativecommons.org/licenses/by/4.0 This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0
spellingShingle 3400
Du, Fengli
Wang, Guangxin
Wang, Dawei
Su, Guoying
Yao, Guixiang
Zhang, Wei
Su, Guohai
Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases
title Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases
title_full Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases
title_fullStr Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases
title_full_unstemmed Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases
title_short Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases
title_sort targeted next generation sequencing revealed a novel deletion-frameshift mutation of kcnh2 gene in a chinese han family with long qt syndrome: a case report and review of chinese cases
topic 3400
url https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7220270/
https://www.ncbi.nlm.nih.gov/pubmed/32311972
http://dx.doi.org/10.1097/MD.0000000000019749
work_keys_str_mv AT dufengli targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases
AT wangguangxin targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases
AT wangdawei targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases
AT suguoying targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases
AT yaoguixiang targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases
AT zhangwei targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases
AT suguohai targetednextgenerationsequencingrevealedanoveldeletionframeshiftmutationofkcnh2geneinachinesehanfamilywithlongqtsyndromeacasereportandreviewofchinesecases