Five novel globin gene mutations identified in five Chinese families by next‐generation sequencing

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. METHODS: Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.