Cargando…

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (A(Br)), 8-oxo-2′-deoxyadenosi...

Descripción completa

Detalles Bibliográficos
Autores principales:	Festa, Carmen, Esposito, Veronica, Benigno, Daniela, De Marino, Simona, Zampella, Angela, Virgilio, Antonella, Galeone, Aldo
Formato:	Online Artículo Texto
Lenguaje:	English
Publicado:	MDPI 2022
Materias:	Article
Acceso en línea:	https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8835054/ https://www.ncbi.nlm.nih.gov/pubmed/35163018 http://dx.doi.org/10.3390/ijms23031092

Ejemplares similares

Structural and Biological Features of G-Quadruplex Aptamers as Promising Inhibitors of the STAT3 Signaling Pathway
por: Esposito, Veronica, et al.
Publicado: (2023)

Strand directionality affects cation binding and movement within tetramolecular G-quadruplexes
por: Šket, Primož, et al.
Publicado: (2012)

Exploring New Potential Anticancer Activities of the G-Quadruplexes Formed by [(GTG(2)T(G(3)T)(3)] and Its Derivatives with an Abasic Site Replacing Single Thymidine
por: Virgilio, Antonella, et al.
Publicado: (2021)

8-Methyl-2′-deoxyguanosine incorporation into parallel DNA quadruplex structures
por: Virgilio, Antonella, et al.
Publicado: (2005)

Monomolecular G-quadruplex structures with inversion of polarity sites: new topologies and potentiality
por: Virgilio, Antonella, et al.
Publicado: (2017)

Probing the Importance of the G-Quadruplex Grooves for the Activity of the Anti-HIV-Integrase Aptamer T30923
por: Esposito, Veronica, et al.
Publicado: (2020)

uL3 Mediated Nucleolar Stress Pathway as a New Mechanism of Action of Antiproliferative G-quadruplex TBA Derivatives in Colon Cancer Cells
por: Pecoraro, Annalisa, et al.
Publicado: (2020)

Effects of abasic sites on structural, thermodynamic and kinetic properties of quadruplex structures
por: Esposito, Veronica, et al.
Publicado: (2010)

The insertion of two 8-methyl-2′-deoxyguanosine residues in tetramolecular quadruplex structures: trying to orientate the strands
por: Virgilio, Antonella, et al.
Publicado: (2012)

Aptamers Against the β-Conglutin Allergen: Insights into the Behavior of the Shortest Multimeric(Intra)Molecular DNA G-Quadruplex
por: O’ Sullivan, Ciara K., et al.
Publicado: (2021)

Covalently Functionalized DNA Duplexes and Quadruplexes as Hybrid Catalysts in an Enantioselective Friedel–Crafts Reaction
por: Dey, Surjendu, et al.
Publicado: (2020)

Antiproliferative Effects of the Aptamer d(GGGT)(4) and Its Analogues with an Abasic-Site Mimic Loop on Different Cancer Cells
por: Virgilio, Antonella, et al.
Publicado: (2022)

Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2′-Deoxyguanosine and 2′-Substituted RNA Analogues
por: Virgilio, Antonella, et al.
Publicado: (2023)

Properties and Potential Antiproliferative Activity of Thrombin-Binding Aptamer (TBA) Derivatives with One or Two Additional G-Tetrads
por: Benigno, Daniela, et al.
Publicado: (2022)

Enantioselective sulfoxidation using Streptomyces glaucescens GLA.0
por: Salama, Sara, et al.
Publicado: (2020)

Bisguanidinium dinuclear oxodiperoxomolybdosulfate ion pair-catalyzed enantioselective sulfoxidation
por: Zong, Lili, et al.
Publicado: (2016)

Enantioselective Sulfonylation Reactions Mediated by a Tetrapeptide Catalyst
por: Fiori, Kristin Williams, et al.
Publicado: (2009)

Functionalized Magnetic Nanoparticles as Catalysts for Enantioselective Henry Reaction
por: Sappino, Carla, et al.
Publicado: (2019)

Theonella: A Treasure Trove of Structurally Unique and Biologically Active Sterols
por: Festa, Carmen, et al.
Publicado: (2023)

Histidine-based copper tetrapeptides as enantioselective catalysts for aldol reactions
por: Sharifa Zaithun, Begum, et al.
Publicado: (2018)

Structurally Defined Molecular Hypervalent Iodine Catalysts for Intermolecular Enantioselective Reactions
por: Haubenreisser, Stefan, et al.
Publicado: (2015)

Chiral 1,3,2-Oxazaborolidine Catalysts for Enantioselective Photochemical Reactions
por: Schwinger, Daniel P., et al.
Publicado: (2020)

Organocatalytic Enantioselective Michael Reaction of Aminomaleimides with Nitroolefins Catalyzed by Takemoto’s Catalyst
por: Mu, Hongwen, et al.
Publicado: (2022)

Fluorine-induced diastereodivergence discovered in an equally rare enantioselective syn-aza-Henry reaction
por: Bing, Jade A., et al.
Publicado: (2022)

Chiral metallohelices enantioselectively target hybrid human telomeric G-quadruplex DNA
por: Zhao, Andong, et al.
Publicado: (2017)

Microwave-Assisted Synthesis of Nanoporous Aluminum-Based Coordination Polymers as Catalysts for Selective Sulfoxidation Reaction
por: Vinu, Madhan, et al.
Publicado: (2017)

Investigating the properties of TBA variants with twin thrombin binding domains
por: Amato, Teresa, et al.
Publicado: (2019)

Supported bifunctional thioureas as recoverable and reusable catalysts for enantioselective nitro-Michael reactions
por: Andrés, José M, et al.
Publicado: (2016)

Chiral‐at‐Iron Catalyst for Highly Enantioselective and Diastereoselective Hetero‐Diels‐Alder Reaction
por: Hong, Yubiao, et al.
Publicado: (2021)

Primary amines as heterogeneous catalysts in an enantioselective [2,3]-Wittig rearrangement reaction
por: Murre, Aleksandra, et al.
Publicado: (2023)

Chiral cyclopentadienylruthenium sulfoxide catalysts for asymmetric redox bicycloisomerization
por: Trost, Barry M, et al.
Publicado: (2016)

G4LDB: a database for discovering and studying G-quadruplex ligands
por: Li, Qian, et al.
Publicado: (2013)

Structural properties and anticoagulant/cytotoxic activities of heterochiral enantiomeric thrombin binding aptamer (TBA) derivatives
por: Virgilio, Antonella, et al.
Publicado: (2020)

Mechanistic Studies on a Sulfoxide Transfer Reaction Mediated by Diphenyl Sulfoxide/Triflic Anhydride
por: Fascione, Martin A, et al.
Publicado: (2012)

Mild, Selective Sulfoxidation with Molybdenum(VI) cis-Dioxo Catalysts
por: Cantwell, Kelsey E., et al.
Publicado: (2017)

Schiff base complex conjugates of bovine serum albumin as artificial metalloenzymes for eco-friendly enantioselective sulfoxidation
por: Tang, Jie, et al.
Publicado: (2018)

1,3-Diamine-Derived Catalysts: Design, Synthesis, and the Use in Enantioselective Mannich Reactions of Ketones
por: Garg, Yuvraj, et al.
Publicado: (2023)

Swinholide J, a Potent Cytotoxin from the Marine Sponge Theonella swinhoei
por: De Marino, Simona, et al.
Publicado: (2011)

Reversible Hyperpolarization of Ketoisocaproate Using Sulfoxide‐containing Polarization Transfer Catalysts
por: Tickner, Ben. J., et al.
Publicado: (2020)

QGRS-Conserve: a computational method for discovering evolutionarily conserved G-quadruplex motifs
por: Frees, Scott, et al.
Publicado: (2014)

Cannot write session to /tmp/vufind_sessions/sess_3nr78g57e7f6bnaqbvhscf02t5