P453 Aspergillus and aspergillosis in patients in an intensive care unit with mechanical ventilation

POSTER SESSION 3, SEPTEMBER 23, 2022, 12:30 PM - 1:30 PM: Invasive Pulmonary Aspergillosis (IPA) is a relevant opportunistic disease among neutropenic patients with hematological diseases. Besides them, studies have been showing that critically ill patients in intensive care units (ICU), mainly those infected by respiratory virus such as SARS-CoV-2 are also at risk to be co-infected by Aspergillus and developing IPA. OBJECTIVES: We aimed to evaluate the detection of Aspergillus in tracheal samples from patients in an ICU on mechanical ventilation from a tertiary hospital from Southern Brazil, and its relationship with their outcome. METHODS: All samples of tracheal aspirate (TA) from patients admitted to the ICU and in mechanical ventilation from July 2020 to June 2021 were included in the study. We performed three different tests to detect Aspergillus spp.: (1) mycological culture in Sabouraud Agar Dextrose, with macro and microscopy evaluation of the colonies to the identification of Aspergillus section; (2) lateral flow assay for the detection of Aspergillus Galactomannan (GM) performed with the cube reader (IMMY® Diagnostics, OK, USA), using a cut-off of ≥4 (nm/ml); (3) quantitative polymerase chain reaction (qPCR) with GoTaq® Probe qPCR (Promega, Wisconsin, EUA) to amplify the small subunit ribosomal RNA target using the forward (3’ TTGGTGGAGTGATTTGTCTGCT 5’), and reverse (5’ TCTAAGGGCATCACAGACCTG 3’) primers, and the probe (3’ TCGGCCCTTAAATAGCCCGGTCCGC 5). Samples presenting the cycle threshold (CT) <40 were considered positive. DNA obtained from an Aspergillus isolate was used as positive control, and DNA-free water as negative control. Probable aspergillosis was defined in those cases that presented positive results to, at least, two of these tests. RESULTS: A total of 34 patients were included in the study. Causes of ICU admissions were aids complications (n = 11), COVID-19 (n = 9), severe acute kidney disease (n = 6), tuberculosis (n = 1), and other reasons, including post-surgery, septic shock, severe acute respiratory syndrome, and cardiac problems (n = 6). Aspergillus spp. was isolated in culture of the TA in 50% of the patients (17/34), being 12 Aspergillus section Fumigati, three Aspergillus section Flavi, and two Aspergillus section Nigri. TA from eight patients were positive for GM, and five patients had a positive result in the qPCR assay. Probable aspergillosis was confirmed in 20.6% (7/34), being three patients positive in culture and GM, and three in culture and qPCR. One patient was positive in the three tests. COVID-19-associated aspergillosis (CAPA) corresponded to two of these seven cases. The outcome was death in 13/34 patients, 4 of them (31%) had probable aspergillosis. The other three patients, alive, diagnosed with probable aspergillosis, were treated with amphotericin B, desoxicolate plus itraconazole, and survived. The mortality rate was 57.1% (4/7) and 33.3% (9/27) in the group with and without probable aspergillosis, respectively. CONCLUSION: These partial results suggest that aspergillosis can have an important impact in critically ill patients in the intensive care unit of our hospital.