Materias dentro de su búsqueda.
Mostrando 1,121 - 1,140 Resultados de 174,586 Para Buscar '"'39"', tiempo de consulta: 0.56s Limitar resultados
  1. 1121
    “…In the present study, B16 melanoma cell lines expressing recombinant CRT fragment 39-272 (sCRT/39-272) in secreted form (B16-CRT), or recombinant enhanced green fluorescence protein (rEGFP) (B16-EGFP), were constructed for investigation on the roles of sCRT in tumor development. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Calreticulin Fragment 39-272 Promotes B16 Melanoma Malignancy through Myeloid-Derived Suppressor Cells In Vivo
  2. 1122
    por Pezeshki, Mohammad Zakaria
    Publicado 2017
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    39: CONNECTING THE DOTS BETWEEN BEST EVIDENCES REGARDING SOCIAL DETERMINANTS OF PATIENTS OUTCOMES AND HEALTH CARE POLICY MAKING
  3. 1123
    “…The aim of the present study was to explore the molecular mechanisms of miR-133a and ubiquitin-specific protease 39 (USP39) in gastric cancer. Western blot analysis and RT-PCR were employed to measure miR-133a and USP39 expression. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    miR-133a, directly targeted USP39, suppresses cell proliferation and predicts prognosis of gastric cancer
  4. 1124
    “…BACKGROUND: This population-based study was designed to investigate whether consumption of sugar-sweetened beverages (SSB) is associated with lower serum total testosterone concentration in men 20–39 years old. METHODS: All data for this study were retrieved from the National Health and Nutrition Examination Survey (NHANES) 2011–2012. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Sugar-sweetened beverage intake and serum testosterone levels in adult males 20–39 years old in the United States
  5. 1125
    “…Here, we show that CD103(+)CD39(+) tumor-infiltrating CD8 T cells (CD8 TIL) are enriched for tumor-reactive cells both in primary and metastatic tumors. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Co-expression of CD39 and CD103 identifies tumor-reactive CD8 T cells in human solid tumors
  6. 1126
    “…Background: ATP2B1 and STK39 have been introduced as essential hypertension candidate genes. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    ATP2B1 rs2681472 and STK39 rs35929607 polymorphisms and risk of Hypertension in Iranian Population
  7. 1127
    “…Nanoporous golf ball-shaped powders with a surface porous layer consisting of fcc Cu and Cu(3)Au phases have been fabricated by selectively dissolving gas-atomized Ti(60)Cu(39)Au(1) powders in 0.13 M HF solution. The distribution profiles of the Ti(2)Cu and TiCu intermetallic phases and powder size play an important role of the propagation of the selective corrosion frontiers. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Evolution of Nanoporous Surface Layers on Gas-Atomized Ti(60)Cu(39)Au(1) Powders during Dealloying
  8. 1128
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    OSC39: Interrelationship of Tooth and Skin Colour across Different Skin Tones in the Malaysian Population - A Pilot Study
  9. 1129
    “…We show that Rai deficiency enhances the ability of astrocytes to upregulate the expression and activity of the ectonucleotidase CD39, which catalyzes the conversion of extracellular ATP to the immunosuppressive metabolite adenosine, through both contact-dependent and–independent mechanisms. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    A T Cell Suppressive Circuitry Mediated by CD39 and Regulated by ShcC/Rai Is Induced in Astrocytes by Encephalitogenic T Cells
  10. 1130
    “…These results provide insights into the post-transcriptional regulation of glycosyltransferases by SLC39A9, as well as sialoglycan species as SubAB receptors.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    A CRISPR Screen Using Subtilase Cytotoxin Identifies SLC39A9 as a Glycan-Regulating Factor
  11. 1131
    “…Two novel 3-decalinoyltetramic acid (3DTA) derivatives, namely fusarisetins C and D (1 and 2), and four known derivatives (3–6) were isolated from the marine-derived fungus Fusarium equiseti D39. Their structures were determined by spectroscopic data, vibrational circular dichroism (VCD) calculations, and X-ray crystallography. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Bioactive 3-Decalinoyltetramic Acids Derivatives From a Marine-Derived Strain of the Fungus Fusarium equiseti D39
  12. 1132
    “…We conducted a retrospective review of salivary gland tumors registered in the Hiroshima Tumor Tissue Registry over a period of 39 years. The subjects were 5015 cases ranging in age from 6 to 97 (mean, 54.3) years old. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Characteristics of 5015 Salivary Gland Neoplasms Registered in the Hiroshima Tumor Tissue Registry over a Period of 39 Years
  13. 1133
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    C-Terminal Fragment, Aβ(39–42)-Based Tetrapeptides Mitigates Amyloid-β Aggregation-Induced Toxicity
  14. 1134
    “…No significant differences in CD39 expression level was found in MAS and SAS patients compared with the HV group. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    CD73 Rather Than CD39 Is Mainly Involved in Controlling Purinergic Signaling in Calcified Aortic Valve Disease
  15. 1135
    “…It identified two subsets which emerged within CD39(−)Treg of NDMM patients that were negligible or absent in CD39(−)Treg of MGUS patients. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Mass Cytometry Discovers Two Discrete Subsets of CD39(−)Treg Which Discriminate MGUS From Multiple Myeloma
  16. 1136
    “…As a histone methyltransferase, SUV39H2 can trimethylate H3K9. SUV39H2 is highly expressed in many types of human tumors, while the function of SUV39H2 in the development and progression of glioma has never been elucidated. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Histone methyltransferase SUV39H2 regulates cell growth and chemosensitivity in glioma via regulation of hedgehog signaling
  17. 1137
    “…Enterococcus mediterraneensis strain Marseille-P4358(T) (= CSURP4358(T)) is a new species isolated from the stool of a 39-year-old male Pygmy from the Democratic Republic of Congo.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Enterococcus mediterraneensis sp. nov., a new bacterium isolated from the stool of a 39-year-old Pygmy
  18. 1138
    “…METHODS: The aim of this study was to characterize the CREBBP genetic variant spectrum in 39 RSTS patients using Multiplex Ligation‐dependent Probe Amplification and DNA sequencing techniques (Sanger and Trio‐based whole‐exome sequencing). …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    New insights into genetic variant spectrum and genotype–phenotype correlations of Rubinstein‐Taybi syndrome in 39 CREBBP‐positive patients
  19. 1139
    “…A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses
  20. 1140
    “…Mechanistically, Kindlin-2 interacts with histone methyltransferase SUV39H1 and recruits it to GATA4 promoter leading to the occupancy of histone H3K9 di- and tri-methylation. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Kindlin-2 suppresses transcription factor GATA4 through interaction with SUV39H1 to attenuate hypertrophy
Herramientas de búsqueda: RSS