“…METHODS: An exploratory qualitative study was conducted on 24 in-depth interviews with health extension workers, religious leaders, women developmental army leaders, and selected community members; and 12 focus group discussions, six with female and six with male community members. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: A cohort study of US Army Infantry trainees at Fort Benning, GA (June and September 2015). …”
Enlace del recurso
Enlace del recurso

Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Patients will be enrolled 2 weeks after the start of detoxification, at which time all subjects will be inpatients at the Stavanger Salvation Army Treatment Center in the Norwegian specialized healthcare system. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: The FMP013 vaccine, was composed of nearly full-length soluble P. falciparum CSP produced in Escherichia coli and was adjuvanted with the Army liposomal formulation (ALFQ). Three doses of the vaccine were administered in InR and ChR (n = 6) at 1-month intervals and the antibody and T cell responses were assessed. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: We analyzed 530 preterm infants who visited the outpatient departments at Xinqiao Hospital of Army Medical University and Maternal and Child Health Care Hospitals of Wanzhou and Yongchuan Districts in Chongqing from September 1, 2016, to August 31, 2017. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: Six multispecialty member US Navy Fleet Surgical/US Army Forward Surgical Teams (total n=99 evaluations) underwent a 6-day surgical training simulation using movie industry special effects and role players wearing the Human Worn Surgical Simulator (Cut Suit). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Bangladesh is currently hosting more than one million stateless Rohingya refugees, who fled from the Rakhine State to avoid genocide and serious crimes against humanity persecuted by the Myanmar Army. The newly arrived Rohingyas were accommodated in overcrowded refugee camps in Cox's Bazar District (CBD). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Being in a professional, technical or managerial position was highly protective against smoking while being engaged in services, skilled and unskilled manual labor, and the army had significantly greater odds of smoking. CONCLUSIONS: Data indicate that tobacco use in the DRC, as is common in the developing world, is heavily concentrated in the working poor with lower educational status. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Service members who were in the Army or Marines, active duty (vs. reserves/national guard), and previously deployed with high levels of combat had increased risk for problematic anger. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…These methods were successfully implemented for in-house production at UNMC and at Tripler Army Medical Center (Honolulu, Hawaii). Overall, the decontamination protocol was highly effective against both E. coli and S. aureus, achieving a ≥4 log10 (99.99%) reduction in colony counts for every replicate from each component of the face shield unit. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: Participants were 103 486 hypertension-free U.S. Army active-duty soldiers (mean age 28.96 years, 61.76% White, 20.04% Black, 11.01% Hispanic, 4.09% Asian, and 3.10% others). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…OBJECTIVE: To explore the risk factors, pathogenic bacteria distribution and drug resistance of systematic transrectal ultrasound-guided prostate biopsy (TRUS-Bx), 329 cases of TRUS-Bx were collected, retrospectively, in the Second Affiliated Hospital, Army Military Medical University, from April 2017 to October 2019. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: From July 2018 to July 2019, in the Department of Gastroenterology at Daping Hospital, Army Military Medical University, a total of 50 patients with IBD were included in this study, and 24 healthy examinees were randomly selected as the control group. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Progressively, smartphones have become the pocket Swiss army knife for everyone. They support their users needs to accomplish tasks in numerous contexts. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…RESULTS: Late initiation of antenatal care (AOR = 4.6, 95% CI = 1.2, 17.1), husbands only decision-making (adjusted odds ratio [AOR] =7.2, 95% CI = 2.1, 24.5), women’s preference for traditional birth attendants (TBAs) (AOR = 3.9, 95% CI = 1.2, 12.5), and not involving in women’s development army (WDA), (AOR = 3.3, 95% CI = 1.0, 10.5) increased the risk of home delivery. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The diagnosis, most prevalent among the Army, heavily relied on self-reported histories. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Methods  We evaluated 101 samples obtained from an enriched cohort of NSCLCs patients from the Army Hospital Research and Referral, New Delhi, India, between November 2016 and November 2018. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…We evaluated the impact of transfers on nosocomial infections for patients who received ECMO at Brooke Army Medical Center (BAMC). METHODS: All patients who received ECMO for ≥48 hours at BAMC between May 2012 and October 2019 were included. …”
Enlace del recurso
Enlace del recurso