Mostrando 2,401 - 2,420 Resultados de 44,672 Para Buscar '"Genus"', tiempo de consulta: 0.23s Limitar resultados
  1. 2401
  2. 2402
    “…This represents a rather rare case of the presence of an extant insect genus in the Mesozoic. Three new species of Paleoplatyura are described, indicating that this genus was relatively diverse already in the Cretaceous. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  3. 2403
    “…We also observed that inulin re-shaped the intestinal microbiota at the phylum level, were Verrucomicrobia genus significantly increased in the fat-diet group; specifically, we observed that Akkermansia muciniphila increased by 5-fold with inulin supplementation. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  4. 2404
  5. 2405
    “…A novel dsRNA virus named “Thelonectria quadrivirus 1” (TQV1) was found in a member of the genus Thelonectria (Ascomycota), isolated from a root associated with stem collar necrosis of Fraxinus excelsior L. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  6. 2406
    “…The members of the Nesterenkonia genus have been isolated from various habitats, like saline soil, salt lake, sponge-associated and the human gut, some of which are even located in polar areas. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  7. 2407
  8. 2408
  9. 2409
  10. 2410
  11. 2411
    por Chen, Qi, Hu, Haisu, Zhang, Dequan
    Publicado 2022
    “…The Fritillaria is an extremely complicated genus in taxonomy and phylogeny, which contains numerous medicinal species in China. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  12. 2412
  13. 2413
    “…The plant genus Mercurialis includes dioecious, monoecious and androdioecious species (where males coexist with hermaphrodites). …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  14. 2414
  15. 2415
    por Lin, Ye-Jie, Yan, Xunyou, Li, Shuqiang
    Publicado 2022
    “…BACKGROUND: Haplocosmia Schmidt & von Wirth, 1996 is a small genus distributed in the Himalayas that includes two species. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  16. 2416
    “…Ferula is a genus of the family Apiaceae and it includes around 170 species of flowering plants mostly native to the Mediterranean region and eastern to central Asia. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  17. 2417
    “…In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  18. 2418
  19. 2419
    “…Two new species of the leafhopper genus Idioscopus Baker are described from China: Idioscopusbihamulussp. nov. and I.ventrispinussp. nov., the latter recorded on a species of Myrica L. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  20. 2420
    “…Alpinia Roxb. is the largest genus of the Zingiberaceae family. A large number of Alpinia species has been used as food and traditional medicines. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
Herramientas de búsqueda: RSS