“…IIV3-HD (39–45%, 17–22%, and 44–48% greater titers for homologous A/Singapore/INFIMH-16–0019/2016—H3N2, historic-drifted A/Switzerland/9715293/2013—H3N2, and forward-drifted A/Wisconsin/19/2017—H3N2, respectively); and comparable HAI titers vs. …”
Enlace del recurso
Enlace del recurso

“…METHODS: Using a social network–based recruitment strategy, we recruited clients of an established SSP in Wisconsin and peers from their social networks. Participants completed a computerized baseline survey and were then randomly assigned to receive the Hep-Net intervention. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Additionally, to compare the post-RT changes in human subjects to those measured in a swine model used to quantify perfusion changes and validate their use as a preclinical model. A cohort of 5 Wisconsin Miniature Swine (WMS) were studied. Additionally, 19 human subjects were recruited as part of an IRB approved clinical trial studying functional avoidance radiation therapy for lung cancer and were treated with SBRT. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…In the present study, individuals and families were recruited at a Lake Michigan beach in Wisconsin in August 2011. Data on recreational water exposure and baseline saliva samples (S1) were collected at recruitment. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: All available retrospective anthropometry data including length/height, weight and head circumference from achondroplasia patients were collected at 4 US skeletal dysplasia centers (Johns Hopkins University, AI DuPont Hospital for Children, McGovern Medical School University of Texas Health, University of Wisconsin School of Medicine and Public Health). Weight-for-age values beyond 3 SD above the mean were excluded from the weight-for-height and weight-for-age curves to create a stricter tool for weight assessment in this population. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…DESIGN, SETTING, AND PARTICIPANTS: From January 2018 through March 2020, the National Rural Opioid Initiative conducted cross-sectional surveys of PWUD in rural communities in 10 states (Illinois, Kentucky, New Hampshire, Massachusetts, North Carolina, Ohio, Oregon, Vermont, West Virginia, and Wisconsin). Participants included rural PWUD who reported any past-30-day injection drug use or noninjection opioid use to get high. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“….: (1) mycological culture in Sabouraud Agar Dextrose, with macro and microscopy evaluation of the colonies to the identification of Aspergillus section; (2) lateral flow assay for the detection of Aspergillus Galactomannan (GM) performed with the cube reader (IMMY® Diagnostics, OK, USA), using a cut-off of ≥4 (nm/ml); (3) quantitative polymerase chain reaction (qPCR) with GoTaq® Probe qPCR (Promega, Wisconsin, EUA) to amplify the small subunit ribosomal RNA target using the forward (3’ TTGGTGGAGTGATTTGTCTGCT 5’), and reverse (5’ TCTAAGGGCATCACAGACCTG 3’) primers, and the probe (3’ TCGGCCCTTAAATAGCCCGGTCCGC 5). …”
Enlace del recurso
Enlace del recurso

“…METHODOLOGY: We used the TriNetX database tool to search clinical data available within the Froedtert and the Medical College of Wisconsin system. The database was searched to identify patients with a diagnosis of type 2 diabetes and FG. …”
Enlace del recurso
Enlace del recurso

“…DESIGN, SETTING, AND PARTICIPANTS: This prospective population-based prognostic study evaluated data from 2 prospective longitudinal cohort studies (the Swedish BioFINDER-1 and the Wisconsin Registry for Alzheimer Prevention [WRAP]), with data collected from February 8, 2010, to October 21, 2020, for the BioFINDER-1 cohort and from August 11, 2011, to June 27, 2021, for the WRAP cohort. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The purpose of this study was to evaluate the behavioral responses of common carp (Cyprinus carpio) to non-physical deterrents within a navigation structure on the Fox River, Wisconsin. Acoustic telemetry combined with hidden Markov models (HMMs) was used to analyze variation in carp responses to treatments. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The storage conditions tested were: Opti-MEM (37°C or 4°C), Krebs-HEPES with 1.8 mmol/L or 2.5 mmol/L calcium (4°C), or Wisconsin (WI) solution at 4°C. Vascular function was evaluated by isometric force testing. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: We identified eligible parent–child dyads from files of managed care organizations in Madison and Milwaukee, Wisconsin, USA, sent them recruitment letters, and randomly assigned them (unblinded) to a control group of treatment as usual plus asthma information or to CHESS+CM. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The greatest proportion of calls were from Wisconsin and Northern Illinois (17%) and the Southeastern United States (14%). …”
Enlace del recurso

“…METHODS: This prospective study collected data at 36 public and private high schools in Wisconsin during the 2012 high school football season. …”
Enlace del recurso
Enlace del recurso

“…METHODS: Subjects (male and female, interscholastic athletes, grades 9 - 12) were recruited from a diverse sample of 29 Wisconsin high schools during the 2015/16 school year to participate in the study. …”
Enlace del recurso
Enlace del recurso

“…Most users owned a pet (65.94%, 962/1459; P<.001), did frequent outdoor activities (recreational or peridomestic; 75.24%, 1094/1454; P<.001 and 64.58%, 941/1457; P<.001, respectively), and lived in the Midwest (56.55%, 824/1457) and Northeast (33.0%, 481/1457) regions in the United States, more specifically in Wisconsin, southern New York, and New Jersey. Users lived more frequently in high-incidence counties for Lyme disease (incidence rate ratio [IRR] 3.5, 95% CI 1.8-7.2; P<.001) and in counties with cases recently increasing (IRR 1.8, 95% CI 1.1-3.2; P=.03). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Measures of cognitive flexibility and attention included the Wisconsin Card Sorting Test (WCST), Continuous Performance Test-Identical Pairs version (CPT-IP), Trail Making Test (TMT), and the D-KEFS Colour Word Interference Test (CWIT). …”
Enlace del recurso
Enlace del recurso

“…In this study, 3,443 patients were enrolled in Louisiana (LA), Massachusetts (MA), North Carolina (NC), Virginia (VA), and Wisconsin (WI) (147, 151, 2,491, 321, and 333, respectively). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…METHODS: Data collection consisted of demographics, observations, audio-recorded contextual inquiries, and semi-structured interviews with staff (e.g., primary care providers, pharmacists, pharmacy technicians) and patients during 1-day site visits to a purposive sample of (1) primary care practices currently using PatientToc™ and (2) community pharmacies in Indiana, Wisconsin, and Minnesota interested in the future use of PatientToc™. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Patients’ geographical regions were assigned to one of the nine divisions defined by the US Census Bureau: East North Central (Illinois, Indiana, Michigan, Ohio, and Wisconsin), East South Central (Alabama, Kentucky, Mississippi, and Tennessee), Mid-Atlantic (New Jersey, New York, and Pennsylvania), Mountain (Arizona, Colorado, Idaho, Montana, Nevada, New Mexico, Utah, and Wyoming), New England (Connecticut, Maine, Massachusetts, New Hampshire, Rhode Island, and Vermont), Pacific (Alaska, California, Hawaii, Oregon, and Washington), South Atlantic (Delaware, Florida, Georgia, Maryland, North Carolina, South Carolina, Virginia, District of Columbia, and West Virginia), West North Central (Iowa, Kansas, Minnesota, Missouri, Nebraska, North Dakota, and South Dakota), and West South Central (Arkansas, Louisiana, Oklahoma, and Texas). …”
Enlace del recurso
Enlace del recurso