Materias dentro de su búsqueda.
Mostrando 244,081 - 244,100 Resultados de 244,269 Para Buscar '"cultural"', tiempo de consulta: 1.46s Limitar resultados
  1. 244081
    “…MTBDRplus assay and MGIT liquid culture performed on 20,245 sputum specimens obtained from presumptive MDR-TB cases during a six-year period from 2013 to 2018 were analyzed retrospectively. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Prevalence and factors associated with multidrug-resistant tuberculosis in South India
  2. 244082
    “…Antibiotic stewardship was not improved by a rapid, highly sensitive rule-out test. Prescribing culture, rather than poor test performance, might explain this absence of effect. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Biomarker-guided antibiotic stewardship in suspected ventilator-associated pneumonia (VAPrapid2): a randomised controlled trial and process evaluation
  3. 244083
    “…SARS CoV-2 PCR was positive following a nasal swab. Urine and blood cultures were negative. Treatment was commenced with intravenous hydrocortisone and antihistamines with resolution of her angioedema symptoms; however, her rash and arthritis persisted. …”
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    EP02 A rare case of Reactive arthritis secondary to COVID-19
  4. 244084
    por Zou, Yun, Vasta, Bhavisha
    Publicado 2020
    “…Microbiology workup showed negative blood cultures, syphilis screen and Hepatitis B and C serology. …”
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    EP14 COVID-19 associated aortitis
  5. 244085
    “…METHODS: BMSCs from New Zealand white rabbits were isolated and cultured in vitro. Then, BMSCs were marked by the cell tracker chloromethyl-benzamidodialkylcarbocyanine (CM-Dil). …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    A novel tissue-engineered bone graft composed of silicon-substituted calcium phosphate, autogenous fine particulate bone powder and BMSCs promotes posterolateral spinal fusion in rabbits
  6. 244086
    “…When these plans are interrupted because of a perinatal loss, it turns out to be a traumatic experience for the family. In Brazilian culture, validating this traumatic grief is very difficult, especially when it happens too soon. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    The perinatal bereavement project: development and evaluation of supportive guidelines for families experiencing stillbirth and neonatal death in Southeast Brazil—a quasi-experimental before-and-after study
  7. 244087
    “…METHODS: Bone marrow-derived MSCs (BMSCs) were harvested from the femurs of Sprague–Dawley rats and cultured in low-glucose Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, with the medium changed every 3 days. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    A Novel Strategy to Enhance Microfracture Treatment With Stromal Cell-Derived Factor-1 in a Rat Model
  8. 244088
    “…BACKGROUND: The translated and culturally adapted German version of the Veterans Rand 36 Items Health Survey (VR-36), and its short form, the VR-12 counterpart, were validated in a German sample of orthopedic (n = 399) and psychosomatic (n = 292) inpatient rehabilitation patients. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Translation and adaptation of the German version of the Veterans Rand—36/12 Item Health Survey
  9. 244089
    “…In adult human islets fetuin-A abolished glucose responsiveness, i.e. 1.7- and 1.1-fold change over 2.8 mmol/l glucose in control- and fetuin-A-cultured islets, respectively. In addition, fetuin-A reduced SMAD2/3 phosphorylation and suppressed expression of proliferative genes. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    The hepatokine fetuin-A disrupts functional maturation of pancreatic beta cells
  10. 244090
    “…Then, human vascular smooth muscle cells (HASMCs) were cultured, and dual luciferase reporter assay was performed to analyse the targeting relationship between miR-513b-5p and COL1A1 or COL1A2. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    MicroRNA-513b-5p targets COL1A1 and COL1A2 associated with the formation and rupture of intracranial aneurysm
  11. 244091
    “…The current study will also be useful addition in ethnobotanical database, preservation of traditional culture and drug discovery and drug development through future ethnopharmacological research.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Inventorization of traditional ethnobotanical uses of wild plants of Dawarian and Ratti Gali areas of District Neelum, Azad Jammu and Kashmir Pakistan
  12. 244092
    “…Amplification PCR : les primers sens (TTACCAGATGATTTTACAGGC) et reverse (AGACTTTAGGTCCACAAAC) [400 nm] amplifient un fragment de 303 pb sous 25-μL avec 12,5 μL de 2X Reaction Mix, 0,5 μL de Superscript II RT/Platinum Taq Mix et 5 μL d’ARN de culture ou 3 μL d’ARN provenant d’échantillons biologiques (30 min/50 °C–2 min/94 °C, puis 40 fois 15 s/94 °C–20 s/55 °C–20 s/68 °C, puis 2 min/72 °C). …”
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    EndoNUclease Heteroduplex Cleavage typing (ENUHCT) : une technique universelle de typage avec concept de preuve sur la détection des variants de spike du SARS-CoV-2
  13. 244093
    “…One of the wild species which has been used in traditional medicine and food recipes by the Totonac culture is Smilax aristolochiifolia (SMILACACEAE), known as “kgentsililh”. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Uses, abundance perception, and potential geographical distribution of Smilax aristolochiifolia Mill (SMILACACEAE) on the Totonacapan Region of Puebla, Mexico
  14. 244094
    “…Of 440 total isolates, 392 (89%) successfully grew in culture and showed excellent drug susceptibility for chloroquine (median half-maximal inhibitory concentration [IC(50)] 20·0 nM [IQR 12·0–26·0]), monodesethylamodiaquine (7·1 nM [4·3–8·9]), pyronaridine (1·1 nM [0·7–2·3]), piperaquine (5·6 nM [3·3–8·6]), ferroquine (1·8 nM [1·5–3·3]), AQ-13 (24·0 nM [17·0–32·0]), lumefantrine (5·1 nM [3·2–7·7]), mefloquine (9·5 nM [6·6–13·0]), dihydroartemisinin (1·5 nM [1·0–2·0]), and atovaquone (0·3 nM [0·2–0·4]). …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Drug susceptibility of Plasmodium falciparum in eastern Uganda: a longitudinal phenotypic and genotypic study
  15. 244095
    “…Blood samples were collected from neonates presenting with clinical signs of sepsis, and WGS and minimum inhibitory concentrations for antibiotic treatment were determined for bacterial isolates from culture-confirmed sepsis. Neonatal outcome data were collected following enrolment until 60 days of life. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Effects of antibiotic resistance, drug target attainment, bacterial pathogenicity and virulence, and antibiotic access and affordability on outcomes in neonatal sepsis: an international microbiology and drug evaluation prospective substudy (BARNARDS)
  16. 244096
    “…When possible, violence prevention efforts should include community-developed, culturally relevant, and evidence-based strategies. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Homicides of American Indians/Alaska Natives — National Violent Death Reporting System, United States, 2003–2018
  17. 244097
    “…In vitro experiments, OGD/R induced marked upregulation of LMP2, proapoptotic protein Bax and cleaved caspase-3, and downregulation of occludin, claudin-1, ZO-1 and Bcl-2, as well as inhibition of the Wnt/β-catenin pathway Wnt-3a and β-catenin proteins in RBMVECs, compared with the control group under normal culture conditions (P < 0.001). However, silencing of LMP2 gene expression reversed these protein changes and promoted proliferation and migration of RBMVECs following OGD/R. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Inhibition of the immunoproteasome LMP2 ameliorates ischemia/hypoxia-induced blood–brain barrier injury through the Wnt/β-catenin signalling pathway
  18. 244098
    “…Total 12-month UTI-related and all-cause visit charges (adjusted), stratified by appropriateness of AB RX at index and during follow-up [Image: see text] CONCLUSION: IA/SO AB RX was associated with higher overall and UTI-related HRU and costs during index episode and 12-month follow-up, highlighting a need for education on applying prescription guidelines and the use of culture-based RX. DISCLOSURES: Rena Moon, MD, Premier Applied Sciences, Premier Inc. …”
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    197. Healthcare Resource Utilization and Costs Associated with Inappropriate and Suboptimal Prescribing of Antibiotics for Uncomplicated Urinary Tract Infection in the United States
  19. 244099
    “…METHODS: A consortium of 30 bacterial isolates including a toxigenic tcdA+ tcdB+ C. difficile strain (CIm_3728T) was cultured from GF Apc(Min/+) mice gavaged with the 3728T slurry. …”
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    1001. Chronic Colonization with Toxigenic Clostridioides difficile Strains Drives Colonic Tumorigenesis in Mice
  20. 244100
    “…The activation of caspase-3 in Vero cells was measured after 1 hour of co-culture with PBMCs, in which cytotoxic cell populations were analyzed by flow cytometry. …”
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Characterization of the Humoral and Cellular Immune Response Against the Natural Infection By Sars-Cov-2 in Oncohematological Patients with Post-COVID19 Autologous Transplantation
Herramientas de búsqueda: RSS