“…Our selection of student models includes the Transformer-based BEiT and the CNN-based ConvNeXt, which achieve accuracies of 98.77% and 96.88%, respectively. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The best result, 88.00FF% accuracy by cross validation, 86.50% by training set, and 64.90% by testing set, indicates the classification model of East (E-region), Northeast (NE-region), and South (S-region) regions could be applied for rough screening. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Utilizing the fluid bed technique, the drug, sustained release (SR) layer, and enteric layer were sequentially prepared by coating MCC pellets with the drug, HPMC, Kollicoat, and a mixture of Eudragit L and Eudragit NE, respectively, resulting in the production of tamsulosin pellets. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The single cell layer of surface ectoderm (SE) which overlies the closing neural tube (NT) plays a crucial biomechanical role during mammalian NT closure (NTC), challenging previous assumptions that it is only passive to the force-generating neuroepithelium (NE). Failure of NTC leads to congenital malformations known as NT defects (NTDs), including spina bifida (SB) and anencephaly in the spine and brain respectively. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Availability: The R programs are freely available for academic users and can be downloaded from http://www.med.niigata-u.ac.jp/eng/resources/informatics/gwa.html Contact: nktmr@m12.alpha-net.ne.jp Supplementary information: Supplementary data are available at Bioinformatics online.…”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The association with hyperglycaemia was most pronounced for antidepressants with affinity for the 5-HT(2c) receptor, histamine-(1) receptor and norepinephrinic (NE) reuptake transporter. The association with hypoglycaemia was most pronounced for antidepressants with affinity for the serotonin reuptake transporter. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The impacts of gasoline exposure on Na(+), K(+)-ATPase, superoxide dismutase (SOD), acetylcholinesterase (AChE), total protein, reduced glutathione (GSH), and lipid peroxidation (TBARS) in the cerebral cortex, and monoamine neurotransmitters dopamine (DA), norepinephrine (NE) and serotonin (5-HT) in the cerebral cortex, hippocampus, cerebellum and hypothalamus were evaluated. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The result of the current study suggests that stress-induced high norepinephrine (NE) release may accompany poorer attention performance in patients with ADHD.…”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The two mol­ecules in the asymmetric unit have almost the same structure, with slight differences in the torsion angles between the substituents and the cyclo­hexane ring; the corresponding N(1)—(C—C—C)(cyclo­hexa­ne) torsion angles are −177.2 (3) and 179.3 (4)° in one mol­ecule and −176.5 (3) and 178.4 (4)° in the other. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…In acutely damaged rat liver mRNA of MPO increased 2.8-fold at 24 h after administration of CCl(4) and 3.3-fold at 3 h after γ-Irradiation and MPO was detected by immunofluorescence double staining only in elastase (NE) positive NGs but not in macrophages (ED1 or CD68 positive cells). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The nuclear pore complex (NPC) regulates molecular traffic across the nuclear envelope (NE). Selective transport happens on the order of milliseconds and the length scale of tens of nanometers; however, the transport mechanism remains elusive. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…We sampled blood at a fast rate (1/10 min) and monitored blood pressure and heart rate continuously. We show that plasma NE and E levels did not differ between hypertensives and normotensive during sleep as well as before and after sleep. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The present results suggest that neurons expressing NK1 receptor within the MDH might be modulated by GABAergic and glycinergic inhibitory intrinsic neurons located in the MDH and 5-HT- or norepinephrine (NE)-containing descending fibers originated from structures in the brainstem.…”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…We investigated the influence of an interaction between local arbuscular mycorrhizal (AM) fungal and pathogenic/saprobic microbial assemblages on the growth of two different plant species from semi-arid grasslands in NE Germany (Mallnow near Berlin). In a greenhouse experiment each plant species was grown for six months in either sterile soil or in sterile soil with one of three different treatments: 1) an AM fungal spore fraction isolated from field soil from Mallnow; 2) a soil pathogen/saprobe fraction consisting of a microbial community prepared with field soil from Mallnow and; 3) the combined AM fungal and pathogen/saprobe fractions. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Typical canyon-related processes, including locally enhanced internal tides and focussed downslope organic carbon transport, provide favourable environmental conditions (current regime, food input) to sustain the communities, even outside the optimal depth and density envelopes reported elsewhere in the NE Atlantic. Our findings show that deep-sea canyons can form natural refuges for faunal communities sensitive to anthropogenic disturbance, and have the potential to fulfil the crucial role of larval sources for the recolonisation of damaged sites elsewhere on the margin.…”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The highlights of this issue include, among others, a description of neXtProt, a knowledgebase on human proteins; a detailed explanation of the principles behind the NCBI Taxonomy Database; NCBI and EBI papers on the recently launched BioSample databases that store sample information for a variety of database resources; descriptions of the recent developments in the Gene Ontology and UniProt Gene Ontology Annotation projects; updates on Pfam, SMART and InterPro domain databases; update papers on KEGG and TAIR, two universally acclaimed databases that face an uncertain future; and a separate section with 10 wiki-based databases, introduced in an accompanying editorial. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…In the crystal structure of the title compound {systematic name: (1′S,2R,2′R,3′S,6′R)-3′-ethyl-4-methyl-5H-5′-oxa-10′-aza­spiro­[furan-2,4′-tricyclo­[8.3.0.0(2,6)]trideca­ne]-5,11′-dione hemihydrate}, C(17)H(23)NO(4)·0.5H(2)O, the asymmetric unit contains two mol­ecules of tuberostemoamide with similar conformations and one water mol­ecule. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…In field experiments we tested the separate and interactive effects of two stressors associated with storminess–loss of a canopy-forming species and mechanical disturbances–on species synchrony and community respiration of intertidal hard-bottom communities on Helgoland Island, NE Atlantic. Treatments consisted of regular removal of the canopy-forming seaweed Fucus serratus and a mechanical disturbance applied once at the onset of the experiment in March 2006. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…When Afro-Brazilian and Whites were analyzed together, there was a higher frequency of the -398T allele in patients than in healthy individuals (p-value = 0.0291). CONCLUSION: ne patient was homozygous for the -398T allele. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso