“…Here we generated iPSC lines from fibroblasts obtained from three individuals affected with DRVT carrying distinct mutations in the SCN1A gene (nonsense mutation p.Ser1516*, missense mutation p.Arg1596His, and splicing mutation c.2589+2dupT). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Seventeen different alleles were identified, namely eight missense variants, six nonsense variants, one in-frame deletion variant, and two splice site variants. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…All patients carried previously unreported missense and nonsense variants. Enzymatic analyses showed multiple OXPHOS deficiencies in biopsies from two patients, whereas immunoblot analyses revealed a decreased abundance of ELAC2 in fibroblasts from three patients. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…In addition, a novel variant with 47bp lacking from exon 12 increased expression in Alzheimer’s Disease brains, accounting for 13% of total INPP5D expression, and was found to undergo nonsense-mediated decay. Although inter-individual variation obscured a possible polymorphism effect on INPP5D isoform expression as measured by qPCR, rs35349669 was associated with rs1141328 allelic expression imbalance, suggesting that rs35349669 is significantly associated with full-length INPP5D isoform expression. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…An XM_023255678.2:c.397C>T nonsense variant in the L2HGDH gene encoding L‐2‐hydroxyglutarate dehydrogenase was identified using whole genome sequencing. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Utilizing RNA-seq datasets for 186 RNA binding protein knockdowns, nonsense mediated RNA decay inhibition, and pharmacologic splicing inhibition, we illustrate the utility of SpliceTools to distinguish splicing disruption from regulated transcript isoform changes, we show the broad transcriptome footprint of the pharmacologic splicing inhibitor, indisulam, we illustrate the utility in uncovering mechanistic underpinnings of splicing inhibition, we identify predicted neo-epitopes in pharmacologic splicing inhibition, and we show the impact of splicing alterations induced by indisulam on cell cycle progression. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Exome sequencing showed that the female fetus carried a de novo nonsense variant in DLX5. The literature search permitted the collection of information on 43 patients with FATCO, the majority of whom were males diagnosed postnatally. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Biochemically, MOV10 forms a complex with UPF1, a key component of the nonsense-mediated mRNA decay pathway, and primarily binds to the 3′ UTR of somatically expressed transcripts in testis. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…We diagnosed the disease in 11 more patients from three unrelated families, caused by the same heterozygous nonsense variant c.148C>T (p.Arg50Ter) in the SGMS2 gene. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient’s genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Arabidopsis DCP1-ASSOCIATED NYN ENDORIBONUCLEASE 1 (DNE1) is a cytoplasmic mRNA decay factor that interacts with proteins involved in mRNA decapping and nonsense-mediated mRNA decay (NMD). There is limited information on the functional role of DNE1 in RNA turnover, and the identities of its endogenous targets are unknown. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The significance of rare nonsense variants remains unclear. Furthermore, no data regarding the RNA expression in affected patients are available. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Most DTPS-causing GPVs are nonsense or frameshifting, with tumor development requiring a second somatic missense hit that impairs the DICER1 RNase IIIb domain. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Using The Cancer Genome Atlas SpliceSeq database, The Cancer Genome Atlas, and the International Cancer Genome Consortium cohorts, we comprehensively analysed potential tumour antigens of ccRCC associated with aberrant alternative splicing, somatic mutation, nonsense-mediated mRNA decay factors, antigen-presenting cells, and overall survival. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…We describe the missense variant ITGB3c.1199G>A, which is considered pathogenic; in addition, we discovered the nonsense variant CDH1c.499G>T, which lacks a Reference SNP (rs) Report and is considered likely pathogenic. (4) Conclusions: To the best of our knowledge, this is the first account of a high rate of change in extracellular matrix glycoproteins and adhesion molecules in individuals with adult-onset FSGS. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Conclusion: The pathogenic nonsense variant c.235C>T p. (Gln79*) in the deoxyguanosine kinase gene may be considered a founder mutation in Lebanon. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…In addition, the onset of HCM may be attributed to disturbances in the protein and transcript quality control systems, namely, the ubiquitin–proteasome system and nonsense-mediated RNA dysfunctions. The aforementioned genetic modifications, which appear to be associated with unfavorable lifelong outcomes and are largely influenced by the type of mutation, exhibit a unique array of clinical manifestations ranging from asymptomatic to arrhythmic syncope and even sudden cardiac death. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Splicing analysis revealed that moderate hypothermia significantly represses the inclusion of a poison exon, which, when retained, targets the mRNA for nonsense‐mediated decay. Importantly, we show that HNRNPH1 mediates this cold‐dependent exon skipping via its thermosensitive interaction with a G‐rich motif within the poison exon. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Through a forward genetic screen in zebrafish, we have recovered a recessive mutant phenotype characterized by craniofacial hypoplasia, ventricular hypoplasia, heart failure at 96 h post-fertilization and lethality, and show it is caused by a nonsense mutation in taf5. CRISPR/CAS9 mediated gene editing revealed that these defects where phenocopied by mutations in taf1 and taf5. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Finally, we reveal that isoforms likely targeted by nonsense-mediated decay are down-regulated in U2AF1 S34F cells, suggesting that isoform changes may alter the translational output of those affected genes. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso