“…METHODOLOGY/PRINCIPAL FINDINGS: Primers and TaqMan probes for the specific amplification of T. solium, T. saginata and T. asiatica were designed and successfully optimized to target the internal transcribed spacer I (ITS-1) gene of T. solium and the cytochrome oxidase subunit I (COX-1) gene of T. saginata and T. asiatica. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…All samples were tested for the H. pylori infection using Hpx1 and Hpx2 primers. Quantitative polymerase chain reaction by TaqMan(®) assay was used to quantify TLR9 mRNA from fresh gastric tissues (48 GC, 26 CG, and 14 C). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The family had whole genome sequencing by Sanger technique, and resequenced the mutation with side primers. The CGA to CAA mutation was present at the 686 loci of exon 3 of HNF1A gene in the patient and mother. …”
Enlace del recurso
Enlace del recurso

“…Endocr Rev (2016)2 Azziz, R. et al. Nat Rev Dis Primers (2016)3 Comim, F. V., et al. Hum Reprod (2013)4 Stener-Victorin, E. et al. …”
Enlace del recurso
Enlace del recurso

“…This multiplex PCR typing method was established to detect 9 mutations with specific primers and probes (ΔHV 69/70, K417T, K417N, L452R, E484K, E484Q, N501Y, P681H, and P681R) against the receptor-binding domain of the spike protein of SARS-CoV-2 variants. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…We then tested for SARS-CoV-2 using real-time reverse transcription polymerase chain reaction with primers against at least two coding regions of the viral nucleocapsid protein (N1 and N2 or E) of SARS-CoV-2. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…Amplification of the 18 S rDNA region (coding for the 18 S RNA) using ZM primers followed by sequencing revealed the presence of R. arrhizus. …”
Enlace del recurso
Enlace del recurso

“….: (1) mycological culture in Sabouraud Agar Dextrose, with macro and microscopy evaluation of the colonies to the identification of Aspergillus section; (2) lateral flow assay for the detection of Aspergillus Galactomannan (GM) performed with the cube reader (IMMY® Diagnostics, OK, USA), using a cut-off of ≥4 (nm/ml); (3) quantitative polymerase chain reaction (qPCR) with GoTaq® Probe qPCR (Promega, Wisconsin, EUA) to amplify the small subunit ribosomal RNA target using the forward (3’ TTGGTGGAGTGATTTGTCTGCT 5’), and reverse (5’ TCTAAGGGCATCACAGACCTG 3’) primers, and the probe (3’ TCGGCCCTTAAATAGCCCGGTCCGC 5). …”
Enlace del recurso
Enlace del recurso

“…Genomic DNA was extracted from blood samples and Cytokine genotyping was carried out by Amplification Refractory Mutations System-Polymerase Chain Reaction (ARMS-PCR) with sequence-specific primers. Three SNPs (IL10-1082A/G; IL10-819/592C/T; IFN-g +874A/T) in two cytokine genes were assessed in all the patients and healthy controls. …”
Enlace del recurso
Enlace del recurso

“…METHODS: Genomic DNA was isolated from C. parapsilosis, followed by PCR amplification of Sap2 gene using designed gene-specific primers. Sap2 protein expression and purification was performed using Ni-NTA affinity chromatography under denaturing conditions. …”
Enlace del recurso
Enlace del recurso

“…Pre-selective followed by selective amplification reactions were performed using EcoRI-AC [6-carboxyfluorescein (6-FAM) labeled] and HindIII-T selective primers. The similarity coefficient was determined by Pearson correlation with negative similarities clip to zero. …”
Enlace del recurso
Enlace del recurso

“…KIR and HLA genotyping was performed with PCR-SSP by some novel primers for 181 patients with AML and 181 healthy controls. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…RESULTS: The expected cDNA fragment of approximately 1240 bp was successfully amplified by PCR using primers designed to select for the coding region of the N protein. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…RESULTS: Five hundred and ninety six SNPs classified into eight subsets including quality control, indica-indica variation, highly polymorphic, functional genes, key genes targeting sites, gene cloned region, important trait associated and gap filling sites were chosen to design KASP primers and 565 out of them were successfully designed, and the assay design success rate was 94.8%. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…ERRγ1 mRNA and Aro mRNA variants were analyzed by Real-time RT-PCR with primers for total (TotAro, Ex2-Ex3), and active (ActAro, Ex9-Ex10)Aro. …”
Enlace del recurso
Enlace del recurso

“…Fluorescence microscopy and genomic PCR analyses using pig mtDNA-specific and GFP primers showed that the PC-iPS cell derivatives could be detected in both mouse and pig pre-implantation blastocysts and post-implantation conceptuses. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…RNA was isolated from cells transfected with WT and mutant GH1 gene and analyzed by RT PCR using primers in the second and fifth exons of GH1 that could identify all possible isoforms of GH1 mRNA. …”
Enlace del recurso
Enlace del recurso

“…Quantitative RT-PCR was conducted using commercially available, pre-designed TaqMan primers and probes targeting ACE2. The ACE2 relative level was calculated after normalization to beta Actin and GAPDH, with lowest ACE2 level being set to 1. …”
Enlace del recurso
Enlace del recurso

“…Polymerase chain reaction (PCR) was used to confirm this isolation using specific gene primers for species identification. Subsequently, the isolates were tested for their sensitivity to 14 antibiotics using the Kirby–Bauer method, after which the PCR was conducted again to detect resistance genes: sul1, strA-strB, aadA, bla(TEM), bla(SHV), tetA-tetE, and tetM. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

“…The tiling multiplex polymerase chain reaction (PCR) was carried out with twenty-five pairs of long-read primers. The resulting PCR amplicons were used for nanopore library preparation and sequencing. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso