Materias dentro de su búsqueda.
Mostrando 19,501 - 19,520 Resultados de 20,464 Para Buscar '"primer"', tiempo de consulta: 0.50s Limitar resultados
  1. 19501
    “…Antibody tests(DAT &rK39) were performed and later a qPCR assay was employed using kDNA specific primers and probes. Immunological biomarkers examined were ADA level by ADA–MTP kit and quantitative cytokines(IFN-γ, IL-10 and TNF-α) by ELISA. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Conversion of asymptomatic infection to symptomatic visceral leishmaniasis: A study of possible immunological markers
  2. 19502
    “…Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome
  3. 19503
    “…The source of blood meal of the engorged females was determined using a multiplex PCR methodology and specific primers of cytochrome b gene of mitochondrial DNA for human, goat, cow, and dog. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Studies of host preferences of wild-caught Phlebotomus orientalis and Ph. papatasi vectors of leishmaniasis in Sudan
  4. 19504
    “…HLA typing was performed using PCR sequence-specific primers in a high-resolution modality, including HLA-DRB1 and HLA-DQB1 loci. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    A major genetic determinant of autoimmune diseases is associated with the presence of autoantibodies in hypersensitivity pneumonitis
  5. 19505
    “…Cell numbers were evaluated by quantitative real-time polymerase chain reaction using specific primers for human MSCs (hMSCs), which indicated that up to 10(6) hMSCs, corresponding to ∼3.9% of the systemically applied human cells, engrafted within the RAAs of RFCA-treated pigs. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Quantitative Efficacy and Fate of Mesenchymal Stromal Cells Targeted to Cardiac Sites by Radiofrequency Catheter Ablation
  6. 19506
    “…Complete genome amplification using ARTIC network V3 multiplex primers was performed followed by next-generation sequencing. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    SARS-CoV-2 genomic and quasispecies analyses in cancer patients reveal relaxed intrahost virus evolution
  7. 19507
    “…A modified reverse transcription reaction, which consists of the use of a SARS-CoV-2 specific primers pool from the Ion AmpliSeq SARS-CoV-2 Research Panel, was assessed in order to promote viral RNA specific reverse transcription. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Evaluation of the Ion AmpliSeq SARS-CoV-2 Research Panel by Massive Parallel Sequencing
  8. 19508
    “…MATERIALS AND METHODS: Sperm samples (n=22) underwent reverse-transcription quantitative polymerase chain reaction using specific primers to detect IGF2 and IGF1R mRNA levels. They were then correlated with patients' conventional sperm parameters using the Spearman (τ) and Kendall (ρ) rank correlation coefficients. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    IGF2 and IGF1R mRNAs Are Detectable in Human Spermatozoa
  9. 19509
    “…RT-nested PCR, using F gene-specific primers, was performed on the cultured isolates, and the products were sequenced and deposited to Genbank with accession numbers MT179304, MT024766, and MT0244767. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Circulation of Indigenous Bovine Respiratory Syncytial Virus Strains in Turkish Cattle: The First Isolation and Molecular Characterization
  10. 19510
    “…PCR was completed using two specific primers targeting aflP and aflA genes involved in the synthetic track of aflatoxin. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Copper-Chitosan Nanocomposite Hydrogels Against Aflatoxigenic Aspergillus flavus from Dairy Cattle Feed
  11. 19511
    “…Polymerase chain response (PCR) and the converse transcription-PCR are transgenic clones of hairy roots has been utilized rolA and rolB particular primers. In the middle of the different attention of better regulators the extreme transformation frequency was achieved in (IBA + NAA) cotyledon explant. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Effect of different Agrobacterium rhizogenes strains for in-vitro hairy root induction, total phenolic, flavonoids contents, antibacterial and antioxidant activity of (Cucumis anguria L.)
  12. 19512
    “…PCR for antigen receptor rearrangements (PARR) by multiple immunoglobulin primers was performed to assess B‐cell clonality. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Polyclonal B‐cell lymphocytosis in English bulldogs
  13. 19513
    “…The latter was an only recently described variant and showed extensive sequence mismatches with the applied real time PCR primers and would therefore not have been detected if tested. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Broad Virus Detection and Variant Discovery in Fecal Samples of Hematopoietic Transplant Recipients Using Targeted Sequence Capture Metagenomics
  14. 19514
    “…The pfhrp2 and pfhrp3 genes were amplified using primers for the region between exons 1 and 2 and for all extension of exon 2. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Evaluation of Histidine-Rich Proteins 2 and 3 Gene Deletions in Plasmodium falciparum in Endemic Areas of the Brazilian Amazon
  15. 19515
    “…Moreover, sequence characterized amplified region (SCAR) primers for rapid identification of this new species were designed.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    A new root-knot nematode, Meloidogyne vitis sp. nov. (Nematoda: Meloidogynidae), parasitizing grape in Yunnan
  16. 19516
    “…Sixty-six of these were also sequenced by using the international HEVnet primers. Genotypes were determined using the BLASTn program. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Autochthonous and Travel Acquired Hepatitis E Virus in Australia
  17. 19517
    “…The DNA extracted from a piece of Formosan Reeves’ muntjac meat was amplified by a pair of specific primers based on its mitochondrial cytochrome b gene for 10 min at a constant temperature ranging from 30 to 45 °C using RPA. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Bushmeat Species Identification: Recombinase Polymerase Amplification (RPA) Combined with Lateral Flow (LF) Strip for Identification of Formosan Reeves’ Muntjac (Muntiacus reevesi micrurus)
  18. 19518
    por Hong, Sae Rom, Shin, Kyoung-Jin
    Publicado 2021
    “…By adopting cytosine-free PCR primers for two differently sized multicopy regions, the short amplicon and long amplicon were obtained from both the genomic and BS-converted DNA, thus enabling the obtaining of reliable and sensitive results and the calculation of the degradation level of the conversion step. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Bisulfite-Converted DNA Quantity Evaluation: A Multiplex Quantitative Real-Time PCR System for Evaluation of Bisulfite Conversion
  19. 19519
    “…DNA was extracted from the leaves using a modified CTAB method for molecular barcode characterization and PCR was performed using primers to amplify the different loci including the plastid genome regions atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer; and the nuclear DNA sequence ITS2. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Molecular barcode and morphological analysis of Smilax purhampuy Ruiz, Ecuador
  20. 19520
    “…Thus, we aimed to develop a sensitive and specific method to detect and discriminate Angiostrongylus third-stage larva by designing species-specific primers based on the mitochondrial cytochrome b gene. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
    Newly developed SYBR Green-based quantitative real-time PCRs revealed coinfection evidence of Angiostrongylus cantonensis and A. malaysiensis in Achatina fulica existing in Bangkok Metropolitan, Thailand
Herramientas de búsqueda: RSS