Mostrando 601 - 620 Resultados de 3,321 Para Buscar '"t.A.T.u."', tiempo de consulta: 2.58s Limitar resultados
  1. 601
  2. 602
  3. 603
  4. 604
    por Yamaguchi, Toshimasa
    Publicado 2022
    “…Cranial computed tomography demonstrated enlarged bilateral ventricles, and the abdominal radiograph demonstrated a reverse U‐shaped catheter that seemed to have been fractured in the left peritoneal cavity.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  5. 605
  6. 606
    “…The encoded protein (UniProt A0A1U8MGX4) was predicted to localize to the nucleus, was found to retain the B3 transcription factor domain with conserved DNA-binding residues and to most closely cluster with REM subfamily members of B3-domain containing proteins.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  7. 607
  8. 608
  9. 609
    “…We then consider models of preheating after hybrid inflation, where the symmetry breaking field is charged under a local U(1) symmetry. We analyze in detail the dynamics of the system in both momentum and configuration space, and show that gauge fields leave specific imprints in the resulting gravitational wave spectra, mainly through the appearence of new peaks at characteristic frequencies that are related to the mass scales in the problem. …”
    Enlace del recurso
    Enlace del recurso
    info:eu-repo/semantics/article
  10. 610
    “…Three-dimensional string models with half-maximal supersymmetry are believedto be invariant under a large U-duality group which unifies the S and Tdualities in four dimensions. …”
    Enlace del recurso
    Enlace del recurso
  11. 611
    por Vretenar, Maurizio
    Publicado 2020
    “…</strong>):&nbsp;</p> <p><a href="https://cern.zoom.us/j/93358147869?pwd=aTRvbU9xZ0lJWU9IcitvamNBWkIwdz09">https://cern.zoom.us/j/93358147869pwd=aTRvbU9xZ0lJWU9IcitvamNBWkIwdz09</a>&nbsp;</p> <p>password: NIMMS</p> <p>&nbsp;</p> <p><strong>Please check this page for updates. …”
    Enlace del recurso
  12. 612
  13. 613
    “…We apply these bounds to well-motivated models, such as the singlet majoron model or a light $U(1)_{L_{\mu }-L_{\tau }}$ gauge boson, and find that they represent the leading constraints for masses $m_X\sim 1\, {\textrm{eV}}$. …”
    Enlace del recurso
    Enlace del recurso
  14. 614
    “…The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.…”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Texto
  15. 615
    “…Neutrophilia was induced in the peritoneal cavity using either ovalbumin/anti-ovalbumin or the complement component C5a. RESULTS: u-PA from a bone marrow-derived cell was required for the full development of CIA. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Texto
  16. 616
  17. 617
    “…Thirteen different recombination patterns included D/A1/D, C/A1, A1/C/A1, A1/U/A1, C/U/A1, C/A1, U/D/U, D/A1/D, A1/C, A1/C, A2/C/A2, CRF10_CD/C/CRF10_CD and CRF35_AD/A1/CRF35_AD. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  18. 618
    “…Eighty four patients were randomized into following groups: placebo (n = 28); BTX-A 25U (n = 27); BTX-A 75U (n = 29). Follow-up visits were conducted every week after the injection, and the overall duration of the study for each patient were 8 weeks to observe the pain severity, efficacy and adverse reactions at endpoint. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  19. 619
    “…BACKGROUND: A biphasic, U-shape relationship has been reported between body mass index (BMI) and clinical outcomes following percutaneous coronary intervention (PCI). …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
  20. 620
    “…Pair-wise sequence alignment revealed the presence of a conserved A-C-x-U-A-x-U-A-x-U-x(5)-U-A-A nucleotide consensus sequence. …”
    Enlace del recurso
    Enlace del recurso
    Enlace del recurso
    Online Artículo Texto
Herramientas de búsqueda: RSS