Materias dentro de su búsqueda.
Materias dentro de su búsqueda.
Enfermería
60
Historia
3
América Latina
1
Antigüedades
1
Arte mexicano
1
Botánica
1
Campesinos
1
Civilización
1
Colección de escritos
1
Congresos
1
Cuentos mexicanos
1
Educación a distancia
1
Educación superior
1
Estudio y enseñanza
1
Movimientos obreros
1
Odontología
1
Partituras, lectura y ejecucion
1
Pedagogía
1
Poes©Ưa portuguesa
1
Poesía mexicana
1
Política económica
1
Política y gobierno
1
Primero de mayo
1
Revoluciones
1
Solfeo
1
Tenencia de la tierra
1
Tojolabal
1
Vida social y costumbres
1
-
601
-
602
-
603
-
604por Yamaguchi, Toshimasa“…Cranial computed tomography demonstrated enlarged bilateral ventricles, and the abdominal radiograph demonstrated a reverse U‐shaped catheter that seemed to have been fractured in the left peritoneal cavity.…”
Publicado 2022
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto -
605
-
606“…The encoded protein (UniProt A0A1U8MGX4) was predicted to localize to the nucleus, was found to retain the B3 transcription factor domain with conserved DNA-binding residues and to most closely cluster with REM subfamily members of B3-domain containing proteins.…”
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto -
607por Konova, Z., Galtseva, I., Kapranov, N., Davydova, J., Drokov, M., Dovidenko, M., Popova, N., Dmitrova, A., Maslikova, U., Starikova, O., Mikhaltsova, E., Koroleva, O., Dubnyak, D., Kolgaeva, E., Omarova, F., Vasilyeva, V., Kuzmina, L., Parovichnikova, E.Enlace del recurso
Publicado 2022
Enlace del recurso
Online Artículo Texto -
608
-
609“…We then consider models of preheating after hybrid inflation, where the symmetry breaking field is charged under a local U(1) symmetry. We analyze in detail the dynamics of the system in both momentum and configuration space, and show that gauge fields leave specific imprints in the resulting gravitational wave spectra, mainly through the appearence of new peaks at characteristic frequencies that are related to the mass scales in the problem. …”
Enlace del recurso
Enlace del recurso
info:eu-repo/semantics/article -
610“…Three-dimensional string models with half-maximal supersymmetry are believedto be invariant under a large U-duality group which unifies the S and Tdualities in four dimensions. …”
Enlace del recurso
Enlace del recurso
-
611The CERN Next Ion Medical Machine Study: towards a new generation of accelerators for cancer therapypor Vretenar, Maurizio“…</strong>): </p> <p><a href="https://cern.zoom.us/j/93358147869?pwd=aTRvbU9xZ0lJWU9IcitvamNBWkIwdz09">https://cern.zoom.us/j/93358147869pwd=aTRvbU9xZ0lJWU9IcitvamNBWkIwdz09</a> </p> <p>password: NIMMS</p> <p> </p> <p><strong>Please check this page for updates. …”
Publicado 2020
Enlace del recurso
-
612por Valiente-Dobón, J.J., Gottardo, A., Benzoni, G., Gadea, A., Lunardi, S., Algora, A., de Angelis, G., Bazzacco, D., Benlliure, J., Boutachkov, P., Bracco, A., Bruce, A.M., Camera, F., Casarejos, E., Cortés, M.L., Crespi, F.C.L., Corsi, A., Domingo-Pardo, C., Doncel, M., Engert, T., Geissel, H., Gerl, J., Goasduff, A., Goel, N., Górska, M., Grebosz, J., Gregor, E., Habermann, T., Klupp, S., Kojouharov, I., Kurz, N., Lenzi, S.M., Leoni, S., Mandal, S., Menegazzo, R., Mengoni, D., Million, B., Morales, A.I., Napoli, D.R., Naqvi, F., Nociforo, C., Pfützner, M., Pietri, S., Podolyák, Zs., Prochazka, A., Recchia, F., Regan, P.H., Rudolph, D., Sahin, E., Schaffner, H., Sharma, A., Sitar, B., Siwal, D., Strmen, P., Szarka, I., Ur, C.A., Walker, P.M., Weick, H., Wieland, O., Wollersheim, H.J., Van Isacker, P.“…The neutron-rich 213 Pb isotope was produced in the fragmentation of a primary 1 GeV A 238 U beam, separated in FRS in mass and atomic number, and then implanted for isomer decay γ -ray spectroscopy with the RISING setup at GSI. …”
Publicado 2020
Enlace del recurso
Enlace del recurso
-
613“…We apply these bounds to well-motivated models, such as the singlet majoron model or a light $U(1)_{L_{\mu }-L_{\tau }}$ gauge boson, and find that they represent the leading constraints for masses $m_X\sim 1\, {\textrm{eV}}$. …”
Enlace del recurso
Enlace del recurso
-
614por Sutou, Shizuyo, Kunishi, Miho, Kudo, Toshiyuki, Wongsrikeao, Pimprapar, Miyagishi, Makoto, Otoi, Takeshige“…The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.…”
Publicado 2007
Enlace del recurso
Enlace del recurso
Enlace del recurso
Texto -
615por Cook, Andrew D, De Nardo, Christine M, Braine, Emma L, Turner, Amanda L, Vlahos, Ross, Way, Kerrie J, Beckman, S Kaye, Lenzo, Jason C, Hamilton, John A“…Neutrophilia was induced in the peritoneal cavity using either ovalbumin/anti-ovalbumin or the complement component C5a. RESULTS: u-PA from a bone marrow-derived cell was required for the full development of CIA. …”
Publicado 2010
Enlace del recurso
Enlace del recurso
Enlace del recurso
Texto -
616por Lim, Ji Hyae, Kim, Shin Young, Park, So Yeon, Lee, Shin Yeong, Kim, Mi Jin, Han, You Jung, Lee, Si Won, Chung, Jin Hoon, Kim, Moon Young, Yang, Jae Hyug, Ryu, Hyun Mee“…M-PDE9A and U-PDE9A levels were obtained in all samples and did not differ between male and female fetuses. …”
Publicado 2011
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto -
617por Kiwelu, Ireen E., Novitsky, Vladimir, Kituma, Elimsaada, Margolin, Lauren, Baca, Jeannie, Manongi, Rachel, Sam, Noel, Shao, John, McLane, Mary F., Kapiga, Saidi H., Essex, M.“…Thirteen different recombination patterns included D/A1/D, C/A1, A1/C/A1, A1/U/A1, C/U/A1, C/A1, U/D/U, D/A1/D, A1/C, A1/C, A2/C/A2, CRF10_CD/C/CRF10_CD and CRF35_AD/A1/CRF35_AD. …”
Publicado 2014
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto -
618por Zhang, Haifeng, Lian, Yajun, Ma, Yunqing, Chen, Yuan, He, Caihong, Xie, Nanchang, Wu, Chuanjie“…Eighty four patients were randomized into following groups: placebo (n = 28); BTX-A 25U (n = 27); BTX-A 75U (n = 29). Follow-up visits were conducted every week after the injection, and the overall duration of the study for each patient were 8 weeks to observe the pain severity, efficacy and adverse reactions at endpoint. …”
Publicado 2014
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto -
619“…BACKGROUND: A biphasic, U-shape relationship has been reported between body mass index (BMI) and clinical outcomes following percutaneous coronary intervention (PCI). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto -
620por Mohanta, Tapan Kumar, Khan, Abdul Latif, Hashem, Abeer, Allah, Elsayed Fathi Abd_, Yadav, Dhananjay, Al-Harrasi, Ahmed“…Pair-wise sequence alignment revealed the presence of a conserved A-C-x-U-A-x-U-A-x-U-x(5)-U-A-A nucleotide consensus sequence. …”
Publicado 2019
Enlace del recurso
Enlace del recurso
Enlace del recurso
Online Artículo Texto