Cargando…
p53 Antisense Oligonucleotide Inhibits Growth of Human Colon Tumor and Normal Cell Lines
We examined the relationship between the expression of mutant p53 proteins and tumor cell growth using a p53 antisense oligonucleotide (5′‐CCCTGCTCCCCCCTGGCTCC‐3′). The oligonucleotide inhibited the growth of three human colon tumor cell lines (DLD‐1, SW620 and WiDr), which produce only mutant p53 p...
Autores principales: | Hirota, Yasuhide, Horiuchi, Tadashi, Akahane, Kouichi |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
Blackwell Publishing Ltd
1996
|
Materias: | |
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5921161/ https://www.ncbi.nlm.nih.gov/pubmed/8698624 http://dx.doi.org/10.1111/j.1349-7006.1996.tb00286.x |
Ejemplares similares
-
Antisense oligonucleotides directed against p53 have antiproliferative effects unrelated to effects on p53 expression.
por: Barton, C. M., et al.
Publicado: (1995) -
Bcl-x(L) antisense oligonucleotides radiosensitise colon cancer cells
por: Wacheck, V, et al.
Publicado: (2003) -
Modulation of p53 Expression Using Antisense Oligonucleotides Complementary to the 5′-Terminal Region of p53 mRNA In Vitro and in the Living Cells
por: Gorska, Agnieszka, et al.
Publicado: (2013) -
Antisense oligonucleotides in neurological disorders
por: Wurster, Claudia D., et al.
Publicado: (2018) -
Molecular Mechanisms of Antisense Oligonucleotides
por: Crooke, Stanley T.
Publicado: (2017)