Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia
BACKGROUND AND AIM: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any fo...
Autores principales: | , , |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
Veterinary World
2020
|
Materias: | |
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7311886/ https://www.ncbi.nlm.nih.gov/pubmed/32636586 http://dx.doi.org/10.14202/vetworld.2020.905-908 |
_version_ | 1783549612099895296 |
---|---|
author | Suryawan, G. Y. Suardana, I. W. Wandia, I. N. |
author_facet | Suryawan, G. Y. Suardana, I. W. Wandia, I. N. |
author_sort | Suryawan, G. Y. |
collection | PubMed |
description | BACKGROUND AND AIM: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. MATERIALS AND METHODS: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5’CATGGGGACGAGGACTATACTATG ’3 and reverse primer: 5’GTAGTCCCAATGTAAGGGATAGCTG’3. RESULTS: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. CONCLUSION: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia. |
format | Online Article Text |
id | pubmed-7311886 |
institution | National Center for Biotechnology Information |
language | English |
publishDate | 2020 |
publisher | Veterinary World |
record_format | MEDLINE/PubMed |
spelling | pubmed-73118862020-07-06 Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia Suryawan, G. Y. Suardana, I. W. Wandia, I. N. Vet World Research Article BACKGROUND AND AIM: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. MATERIALS AND METHODS: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5’CATGGGGACGAGGACTATACTATG ’3 and reverse primer: 5’GTAGTCCCAATGTAAGGGATAGCTG’3. RESULTS: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. CONCLUSION: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia. Veterinary World 2020-05 2020-05-15 /pmc/articles/PMC7311886/ /pubmed/32636586 http://dx.doi.org/10.14202/vetworld.2020.905-908 Text en Copyright: © Suryawan, et al. http://creativecommons.org/licenses/by/4.0 Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. |
spellingShingle | Research Article Suryawan, G. Y. Suardana, I. W. Wandia, I. N. Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia |
title | Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia |
title_full | Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia |
title_fullStr | Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia |
title_full_unstemmed | Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia |
title_short | Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia |
title_sort | sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in indonesia |
topic | Research Article |
url | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7311886/ https://www.ncbi.nlm.nih.gov/pubmed/32636586 http://dx.doi.org/10.14202/vetworld.2020.905-908 |
work_keys_str_mv | AT suryawangy sensitivityofpolymerasechainreactioninthedetectionofratmeatadulterationofbeefmeatballsinindonesia AT suardanaiw sensitivityofpolymerasechainreactioninthedetectionofratmeatadulterationofbeefmeatballsinindonesia AT wandiain sensitivityofpolymerasechainreactioninthedetectionofratmeatadulterationofbeefmeatballsinindonesia |