Cargando…
Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex
[Image: see text] The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications....
Autores principales: | , , , , , , , |
---|---|
Formato: | Online Artículo Texto |
Lenguaje: | English |
Publicado: |
American Chemical Society
2022
|
Acceso en línea: | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8991003/ https://www.ncbi.nlm.nih.gov/pubmed/35324198 http://dx.doi.org/10.1021/jacs.2c00178 |
_version_ | 1784683500487573504 |
---|---|
author | McQuaid, Kane T. Takahashi, Shuntaro Baumgaertner, Lena Cardin, David J. Paterson, Neil G. Hall, James P. Sugimoto, Naoki Cardin, Christine J. |
author_facet | McQuaid, Kane T. Takahashi, Shuntaro Baumgaertner, Lena Cardin, David J. Paterson, Neil G. Hall, James P. Sugimoto, Naoki Cardin, Christine J. |
author_sort | McQuaid, Kane T. |
collection | PubMed |
description | [Image: see text] The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)(2)(qdppz)](2+) displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T(18)), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T(10)–T(11)–A(12). The two remaining wide lateral loops are linked through a third K(+) ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work. |
format | Online Article Text |
id | pubmed-8991003 |
institution | National Center for Biotechnology Information |
language | English |
publishDate | 2022 |
publisher | American Chemical Society |
record_format | MEDLINE/PubMed |
spelling | pubmed-89910032022-04-08 Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex McQuaid, Kane T. Takahashi, Shuntaro Baumgaertner, Lena Cardin, David J. Paterson, Neil G. Hall, James P. Sugimoto, Naoki Cardin, Christine J. J Am Chem Soc [Image: see text] The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)(2)(qdppz)](2+) displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T(18)), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T(10)–T(11)–A(12). The two remaining wide lateral loops are linked through a third K(+) ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work. American Chemical Society 2022-03-24 2022-04-06 /pmc/articles/PMC8991003/ /pubmed/35324198 http://dx.doi.org/10.1021/jacs.2c00178 Text en © 2022 The Authors. Published by American Chemical Society https://creativecommons.org/licenses/by/4.0/Permits the broadest form of re-use including for commercial purposes, provided that author attribution and integrity are maintained (https://creativecommons.org/licenses/by/4.0/). |
spellingShingle | McQuaid, Kane T. Takahashi, Shuntaro Baumgaertner, Lena Cardin, David J. Paterson, Neil G. Hall, James P. Sugimoto, Naoki Cardin, Christine J. Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex |
title | Ruthenium
Polypyridyl Complex Bound to a Unimolecular
Chair-Form G-Quadruplex |
title_full | Ruthenium
Polypyridyl Complex Bound to a Unimolecular
Chair-Form G-Quadruplex |
title_fullStr | Ruthenium
Polypyridyl Complex Bound to a Unimolecular
Chair-Form G-Quadruplex |
title_full_unstemmed | Ruthenium
Polypyridyl Complex Bound to a Unimolecular
Chair-Form G-Quadruplex |
title_short | Ruthenium
Polypyridyl Complex Bound to a Unimolecular
Chair-Form G-Quadruplex |
title_sort | ruthenium
polypyridyl complex bound to a unimolecular
chair-form g-quadruplex |
url | https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8991003/ https://www.ncbi.nlm.nih.gov/pubmed/35324198 http://dx.doi.org/10.1021/jacs.2c00178 |
work_keys_str_mv | AT mcquaidkanet rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT takahashishuntaro rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT baumgaertnerlena rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT cardindavidj rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT patersonneilg rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT halljamesp rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT sugimotonaoki rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex AT cardinchristinej rutheniumpolypyridylcomplexboundtoaunimolecularchairformgquadruplex |